Error
Your session has expired. Please click "Refresh" to refresh the page.
Nuclear Receptor Signaling Atlas
A research resource for the nuclear receptor signaling community
Newsletter Sign Up
ER-β Primer
Overview
Reagent Type
Primer
Molecule
Species
House Mouse
Forward sequence
gccaacctcctgatgcttct
Reverse sequence
tcgtacaccgggaccacat
cDNA Template
Source
NURSA
Datasets