Error
Your session has expired. Please click "Refresh" to refresh the page.
Nuclear Receptor Signaling Atlas
A research resource for the nuclear receptor signaling community
Newsletter Sign Up
DAX1 Primer B
Overview
Reagent Type
Primer
Molecule
Species
House Mouse
Forward sequence
tccggtggtgctgatcaa
Reverse sequence
tctccactgaagaccctcaatgt
cDNA Template
Source
NURSA
Datasets