Error
Your session has expired. Please click "Refresh" to refresh the page.
Nuclear Receptor Signaling Atlas
A research resource for the nuclear receptor signaling community
Newsletter Sign Up
EAR2 Primer
Overview
Reagent Type
Primer
Molecule
Species
House Mouse
Forward sequence
gagggctgcaagagtttcttc
Reverse sequence
tccggtggtgctgatcaa
cDNA Template
Source
NURSA
Datasets